An important approach in identifying the molecular basis of cytoplasmic male sterility and disease toxin sensitivity in T-cytoplasm maize was obtained by the regeneration of plants from tissue culture. These plants displayed mutation to male fertility and insensitivity to two pathotoxins, Helminthosporium maydis race T toxin and Phyllosticta maydis toxin. These traits were shown to be maternally inherited; analysis of chloroplast and mitochondrial DNA restriction patterns revealed variation in mitochondrial DNA with no evidence of change in chloroplast DNA (Gengenbach et al., Theor. Appl. Genet. 59:161, 1981; Brettell et al., MNL 56:13, 1982; Gengenbach and Umbeck, MNL 56:140, 1982; Gengenbach, Pring, and Conde, unpublished results). Most of these lines (e.g., T-7 or R-5) carry an altered 6.7 kb XhoI restriction fragment. Homology to the 6.7 kb XhoI fragment appears at 6.5 kb in these lines. One mutant, T-4, retains the 6.7 kb XhoI fragment, but is distinguishable from parental T mtDNA (A188). In last year's newsletter, we reported that there was a ca. 180 bp AluI fragment in T internal to the 6.7 kb XhoI fragment that was altered in the T-4 mutant. When these fragments were cloned and sequenced, it was found that the alteration was due to a G to A transition followed by a 5 bp insertion. The insertion generates a 5bp-tandem duplication. At present there do not appear to be any other changes.
We have probed BamHI, XhoI, and HindIII digested total mitochondrial DNA from A188(T), T-4, T-7, R-5, and A188(N) (normal, male-fertile cytoplasm) with 16 AluI clones derived from the 6.7 kb XhoI fragment, in addition to clones flanking this region. These analyses showed that T and T-4 are identical in their major and minor hybridization patterns, whereas T-7 and R-5 have undergone a 3 kb deletion generating an N-like genome structure in this region. This deletion extends into a 4.3 kb repeat, through which recombination occurs in T but not N cytoplasm mitochondrial DNA (Lonsdale et al., NAR 12:9249, 1984; Wise et al., MNL 59:50; Wise and Pring, unpublished results). Wf9(T) Rfl Rf2 mtDNA appears identical to T and T-4 in this region.
The insertion in T-4 occurs in sequences that are deleted in T-7 and R-5 and are absent in N mtDNA. In addition, the insertion appears to be centrally located in a 345 bp open reading frame (Dewey and Levings, personal communication). The sequences flanking the insertion carry 86 bp perfect homology to the 3' flanking region of 26S ribosomal DNA. Farther downstream of the insertion is an exact 47 bp homology with the 26S ribosomal DNA coding region. This is not the 26S rDNA region, however. The insertion in T-4 results in sequences which more closely match the 3' flank of the 26S rDNA (Figure 1).
3' flank, 26S rDNA:
GCATGAGCTATCCTTCTCATCTCATGGTTGAGGGGGGTT
T-4:
GCATGAGCTATCCTTCTCATCTCATGGTTGAGGGGGGTT
T:
GCATGAGCTATCCTTCTCG---------TGGTTGAGGGGGGTT
Figure 1. The nucleotide sequence of a transcribed region of mitochondrial DNA from T-cytoplasm maize. The T-4 mutant, male fertile and disease resistant, has a G to A transition and a 5 bp insertion, resulting in a sequence which matches a portion of the 3' flank of 266 ribosomal DNA. Underlined sequence is a 5 bp tandem duplication.
To check for differences in transcription of RNA's, [32P] 5' end labeled mtRNA from T and T-4 was used to probe the 16 AluI clones derived from the 6.7 kb XhoI fragment and flanking regions. No differences were seen between T and T-4. In addition, no apparent differences were seen when [32P] mtRNA's from T and T-4 were used to probe BamHI, XhoI, and HindIII restriction digests of T and T-4 total mitochondrial DNA, suggesting that there are no other obvious changes in expression or rearrangement of coding sequences between T and T-4. However, when [32P] mtRNA from T-7 or N is used to probe the 16 AluI clones, there seems to be a suppression of RNA's that hybridize to the putative open reading frame and 3 kb on either side. This includes a 663 bp open reading frame 3' to the 345 bp ORF (Dewey and Levings, personal communication). Sequences 3' to the 345 bp ORF are not deleted in T-7 or R-5 and are also present in N.
This region displays a complex transcriptional pattern. The T AluI clone which carries the insertion in T-4 hybridizes to six transcripts of ca. 3.5, 2, 1.7, 1.5, 1.0, and 0.8 kb in northern analysis of T and T-4 mtRNA. However, the clone only hybridizes to three transcripts in T-7 or N; the 1.7, weakly to the 1.5, and to a 3.1 kb transcript. The suppression of mtRNA's in T-7 and N which hybridize to sequences in this region can be explained by the deletion of some of the sequences which code for the large transcripts encompassing this region.
There are four basic conclusions we can derive from these data:
1. There are two kinds of mitochondrial DNA rearrangements in the tissue culture derived mutants to male fertility and toxin insensitivity. The rearrangement in the T-4 mutant is due to a G to A transition followed by a 5 bp insertion, while T-7 and R-5 have a 3 kb deletion encompassing a large portion of the 4.3 kb repeat.
2. These sequences are in a region that is heavily transcribed.
3. Transcription in this region is greatly reduced in T-7 or N.
4. Transcription is unaltered in T-4, suggesting that an aberrant gene product or loss of normal translational activity is associated with this mutant.
R. P. Wise, D. R. Pring, and B. G. Gengenbach
Return to the MNL 60 On-Line Index
Return to the Maize Newsletter Index
Return to the Maize Genome Database Page