A microsatellite linked to the ts2 locus
--Alejandro Calderon-Urrea and Stephen L. Dellaporta
The utility of microsatellite sequences as markers for mapping or for rapid genotyping is becoming a routine practice in plant and animal genetics. This technology requires knowledge of DNA sequences flanking the repeat so that the locus-specific PCR primers can be designed. This information may come from DNA sequences already present in DNA databases or from a systematic search for a particular microsatellite repeat by cloning and sequencing. Here we report on the presence of a microsatellite tightly linked to the recently cloned tasselseed2 (ts2) gene (DeLong et al., Cell 74:757-768, 1993). After sequencing 10 kb of genomic DNA from the ts2 locus in W22 inbred material, we found the following repeat: 5'TGGC(AG)32AACGAA3' located 1.5 kb 3' to the ts2 gene. Microsatellite length variability was found in different genetic backgrounds using primers flanking the repeat (OTS98 = 5'TGACGGACGTGGATCGCTTCAC3'; OTS99 = 5'AGCAGGCAGCAGGTCAGCAGCG3'). In the W22 genetic background, these primers amplify a 119 bp PCR product, a size consistent with the product predicted from sequence data. As shown in Figure 1, these primers amplify different length products in all the genetic backgrounds tested that range from 100 bp (lane 6) to 160 bp (lane 4) (all backgrounds carry a functional Ts2 allele). It is interesting to notice that two phenotypically identical P alleles (P-wr), located 2 cM proximal to ts2, are polymorphic for the microsatellite repeat. In summary the data indicate that the ts2-linked microsatellite repeat should be a useful genetic locus for mapping and genotyping purposes.
Conditions for PCR amplification are as follows: 100 ng of genomic DNA were amplified in a 50 uL final volume containing 20 pmoles of each primer, 10 umoles each dNTP, 5 uL of 10X Taq buffer (USB), 2 uL of MgCl2 solution (USB) and one unit of Taq DNA polymerase (USB). PCR was performed in a Perkin-Elmer-Cetus Thermal Cycler with the following profile: i) 95 C for 5 min., 1 cycle; ii) 95 C for 40 sec., 60 C for 40 sec., 72 C for 40 sec., 30 cycles; iii) 72 C for 15 min. PCR products were fractionated in a 4% (3 NuSieve:1 SeaKem FMC) agarose gel run for 4 hours at 65 volts.
Figure
1. Agarose gel electrophoresis of the ts2 linked microsatellite
in four different maize inbred lines. MW, molecular weight markers (BRL
123 bp ladder).
Return
to the MNL 68 On-Line Index
Return to
the Maize Newsletter Index
Return to the
Maize Genome Database Page