How similar are plant telomeres?
--Weck, E and Grasso, G
The comparison of cereal species through RFLP hybridizations has shown a surprising amount of colinearity among the related genomes. Some molecular tools are more useful for intergenomic comparisons than others. RFLPs are generally more useful, probably due to the preservation of large regions of sequence within genes and structural elements of similar function. RAPDs, and perhaps PCR markers in general, may not be as useful, sampling a much smaller region of the genome which varies enough to alter reaction products under the exacting conditions of PCR.
The PCR comparison of common structural elements, such as telomeres, should be useful for intragenomic comparisons. The use of PCR technology offers laboratories working on under-investigated species the opportunity to examine these relationships with currently available microsatellite-like telomere sequences.
We have used a telomere specific primer (Richards and Ausubel, Cell 53:127-36, 1988) which points toward the centromere and a maize subtelomere derived primer to compare maize and rice with a number of other species that are important in developing countries: baselle (Basella spp., African spinach); tef, of great importance in southern Ethiopia; banana, important in tropical countries; and date palm, which is of special agricultural importance in northwest Africa.
The telomere specific primer produced a smear background in all species examined along with a number of distinctive bands for most species (Fig. 1). The maize subtelomere-derived primer produced distinctive band patterns in most species examined. This suggests that primers derived from gross structural features of chromosomes may be generally useful for species comparisons. It will be interesting to examine the sequences of subtelomeres from other plant species. Comments to: weck@ripo1.iaea.or.at
Figure 1. Telomere primer, CCCTAAACCCTAAACCCTAAACCCTA, top, and maize subtelomere primer GAAATTGAGTCTCCCAACCATATC, bottom. L to R, marker (1 kb ladder, GIBCO-BRL), date palm, tef 37, tef KM, baselle (Congo flowering), baselle (Sri Lanka) , rice (IR43), banana (Burro Cemsa), banana (Burro Criollo), maize (Stock center- 909B), maize (325C), and maize (M141); 58 C annealing temperature.
Return
to the MNL 70 On-Line Index
Return to
the Maize Newsletter Index
Return to the
Maize Genome Database Page