A set of microsatellite markers of general utility in maize --Register, JC, III*, Sullivan, HR, Yun, Y, Cook, D, Vaske, DA
* To whom correspondence should be addressed.
Over the past several years microsatellites (often referred to as simple sequence repeats [SSRs] or short tandem repeats [STRs]) have become the most commonly used class of molecular marker for high-throughput genotyping of many higher eukaryotes including maize. During this time we (and others at Pioneer Hi-Bred Int'l Inc.) have, in collaboration with public researchers, made well over 100 SSR markers available for public use (Chin ECL, Senior ML, Shu H, Smith JSC [1996] Genome 39, 866-873; Senior ML, Chin ECL, Lee M, Smith JSC, Stuber CW [1996] Crop Sci 36, 1676-1683; Smith JSC, Chin ECL, Shu H, Smith OS, Wall SJ, Senior ML, Mitchell SE, Kresovich S, Ziegle J [1997] Theor Appl Genet 95, 163-173; also see Maize Genome Database - http://www.agron.missouri.edu ). As is always the case for this kind of resource, broad application of these markers has demonstrated that, for various reasons, some are more useful (i.e. robust, informative, easily scorable, etc.) than are others. We report here on the subset of those markers that we have found to be most useful for our applications.

All PCR primers were designed to work under a single set of conditions in 10 ml reactions. Genomic DNA (10 ng) was amplified in 1.5 mM MgCl2, 50 mM KCl, 10 mM Tris-Cl (pH 8.3) using 0.3U AmpliTaq Gold DNA polymerase (PE Corporation), oligonucleotide primer pairs at 0.17 mM and 0.2 mM dNTPs. This mixture was incubated at 95 C for 10 min (hot start), then amplified by 45 cycles of: denaturation, 95 C for 50 sec; annealing, 60 C for 50 sec; extension, 72 C for 85 sec, followed by a final 10 min 72 C incubation. A water bath thermocycler manufactured at Pioneer Hi-Bred Int'l Inc. was used. PCR products were prepared for analysis using ABI377 Automated DNA Sequencers (PE Corporation) by diluting 3 ml of each product to a total of 27 ml using a combination of other PCR products (multiplexing) and/or dH2O. 1.5 ml of this mixture was then diluted to 5 ml with gel loading dye and analyzed using ABI hardware and software according to manufacturer’s specifications.

The Table below lists approximately 80 markers and relevant associated information. For some markers, PCR primers have been redesigned since their initial publication for optimal performance under the conditions described above. The Table also notes the fluorescent dyes with which each marker is labeled. Minimum and maximum allele sizes were obtained by rounding down or up to the nearest basepair respectively. These sizes and PIC values (Smith JSC, Chin ECL, Shu H, Smith OS, Wall SJ, Senior ML, Mitchell SE, Kresovich S, Ziegle J [1997] Theor Appl Genet 95, 163-173) were obtained from an analysis of over 500 Pioneer Hi-Bred Int'l Inc. proprietary maize genotypes. Even though the PIC and allele range values were obtained working with proprietary Pioneer Hi-Bred Int'l Inc. germplasm, we do know that the values presented here are largely representative of North American dent germplasm in general.
 
MARKER CHROM DISTANCE BIN REPEAT PRIMER SEQUENCE (F / R) MIN/MAX ALLELE* PIC NEARBY LOCI**
phi109275 1 0 1.00 AGCT 6FAMCGGTTCATGCTAGCTCTGC 122 / 140 0.77 umc274, umc275
GTTGTGGCTGTGGTGGTG
phi056 1 9 1.01 CCG NEDACTTGCTTGCCTGCCGTTAC 239 / 259 0.67 rgpc654, bnlg149
CGCACACCACTTCCCAGAA
phi427913 1 26.71 1.01 ACG NEDCAAAAGCTAGTCGGGGTCA 123 / 131 0.23 bnlg1112, bnlg1458
ATTGTTCGATGACACACTACGC
phi339017 1 72 1.01 AGG HEXACTGCTGTTGGGGTAGGG 147 / 157 0.34 csu745d, bnlg2180
GCAGCTTGAGCAGGAAGC
phi002 1 173.9 1.08 AACG HEXCATGCAATCAATAACGATGGCGAGT 71 / 80 0.51 csu580a, bnl17.06
TTAGCGTAACCCTTCTCCAGTCAGC
phi423298 1 174 1.08 CCG NEDGGGCTGCTACTTTGACAAGGAC 128 / 135 0.43 bnl17.06, umc83a
CCTCCATCATCCGCTGGTA
phi323065 1 179 1.08 AGC HEXGATCGATCGACGACCAGC 327 / 334 0.53 csu531, cdo680a
CTTCTGCGTGGGCAAAGA
phi335539 1 181.37 1.08 CCG HEXGAGTCCGCTGAAATTTTGGT 90 / 93 0.17 csu1174, csu745e
TAGAAGCCGCCGTGCCTAT
phi011 1 209 1.09 AGC HEXTGTTGCTCGGTCACCATACC 212 / 232 0.44 npi282b, uat4a
GCACACACACAGGACGACAGT
phi308707 1 220 1.09 AGC  HEXGCAACAAGATCCAGCCGAT 118 / 125 0.39 umc161a, csu63a
GTCGCCCTCATATGACCTTC
phi265454 1 224.63 1.10 AGG 6FAMCAAGCACCTCAACCTCTTCG 220 / 238 0.61 npi238, csu868
TCCACGCTGCTCACCTTC
phi064 1 231 1.11 ATCC 6FAMCCGAATTGAAATAGCTGCGAGAACCT 73 / 110 0.83 csu33b, csu755
ACAATGAACGGTGGTTATCAACACGC
phi227562 1 266 1.11 ACC 6FAMTGATAAAGCTCAGCCACAAGG 309 / 325 0.78 csu1114, csu1193
ATCTCGGCTACGGCCAGA
phi109642 2 0 2.00 ACGG 6FAMCTCTCTTTCCTTCCGACTTTCC 133 / 145 0.58 csu1192, dup1383
GAGCGAGCGAGAGAGATCG
phi402893 2 0 2.00 AGC HEXGCCAAGCTCAGGGTCAAG 209 / 237 0.73 csu1192, dup1383
CACGAGCGTTATTCGCTGT
phi96100 2 6.04 2.00 ACCT 6FAMAGGAGGACCCCAACTCCTG 268 / 297 0.76 rz569b, csu29b
TTGCACGAGCCATCGTAT
phi083 2 86 2.04 AGCT NEDCAAACATCAGCCAGAGACAAGGAC 125 / 139 0.76 bnlg1831, umc184b
ATTCATCGACGCGTCACAGTCTACT
phi328189 2 145 2.08 CCG HEXACGCTCGAAGCAAATCCT 118 / 125 0.64 csu1103, uaz241b
TCGCGCTTGGTAGACGTA
phi251315 2 147.34 2.08 CCG 6FAMCCAGTCCAATGGAGAGGG 126 / 132 0.47 umc88(P450), umc36b
GAGATTCCCCTGCAGGACT
phi127 2 149.79 2.08 AGAC NEDATATGCATTGCCTGGAACTGGAAGGA 110 / 129 0.7 umc4a, bcd808c
AATTCAAACACGCCTCCCGAGTGT
phi435417 2 161 2.08 ACC NEDCTGACGCCACTGTTGCTTG 215 / 220 0.6 uaz239b, bnl8.44b
AAAAGTAGCCAATCTGCCACG
phi090 2 174 2.09 ATATC 6FAMCTACCTATCCAAGCGATGGGGA 139 / 150 0.44 bnlg1520, csu304a
CGTGCAAATAATTCCCCGTGGGA
phi427434 2 186.05 2.08 ACC NEDCAACTGACGCTGATGGATG 123 / 139 0.7 csu200a, csu109a
TTGCGGTGTTAAGCAATTCTCC
phi101049 2 194 2.08 AGAT 6FAMCCGGGAACTTGTTCATCG 229 / 249 0.8 csu665a, csu810a
CCACGTCCATGATCACACC
phi453121 3 0 3.00 ACC NEDACCTTGCCTGTCCTTCTTTCT 213 / 225 0.74 bnl(tas4l), umc32a
CAAGCAAGACTTTTGATCAGCC
phi104127 3 6.88 3.00 ACCG 6FAMCTTTGCTGCTGCTTCCTACG 156 / 166 0.58 php20905, csu628
AACCAGTGACGTACACAAAGCA
phi243966 3 46.8 3.02 AGC 6FAMCGACCGAAACGAATCAAAA 210 / 228 0.63 bnlg1647, umc154
TACTAGGCTGACACGCACG
phi374118 3 52 3.02 ACC HEXTACCCGGACATGGTTGAGC 216 / 230 0.72 umc92a, bnlg2136
TGAAGGGTGTCCTTCCGAT
phi193225 3 55 3.02 AAC 6FAMGCTCTTGGCGTGCTTCTT 133 / 141 0.72 umc92a, bnlg2136
GCGGGGAGGTGAAGAGCTA
phi053 3 67.9 3.05 ATAC 6FAMCTGCCTCTCAGATTCAGAGATTGAC 168 / 195 0.71 cdo459, cdo419a
AACCCAACGTACTCCGGCAG
phi029 3 91 3.04 AG/AGCG*** NEDTTGTCTTTCTTCCTCCACAAGCAGCGAA 142 / 161 0.71 bnlg1796, npi201a
ATTTCCAGTTGCCACCGACGAAGAACTT
phi102228 3 97.05 3.04 AAGC 6FAMATTCCGACGCAATCAACA 122 / 131 0.67 npi328b, bnlg1022
TTCATCTCCTCCAGGAGCCTT
phi073 3 120 3.05 AGC 6FAMGTGCGAGAGGCTTGACCAA 176 / 195 0.65 bnlg1108, umc226a
AAGGGTTGAGGGCGAGGAA
phi072 4 12 4.00 AAAC HEXACCGTGCATGATTAATTTCTCCAGCCTT 141 / 164 0.63 bnlg1241, uaz60
GACAGCGCGCAAATGGATTGAACT
phi295450 4 17.3 4.01 AGG/AAG*** 6FAMCCTTTTCATGTTGCTTTCCC 187 / 199 0.77 cyp5, zp11a
GCCCAATCCTTCCTTCCT
phi213984 4 24.1 4.01 ACC 6FAMGTGACCTAAACTTGGCAGACCC 286 / 304 0.52 umc277, uaz67
CAAGAGGTACCTGCATGGC
phi308090 4 53.03 4.04 AGC 6FAMCAGTCTGCCACGAAGCAA 210 / 223 0.49 csu855, bnlg292b
CTGTCGGTTTCGGTCTTCTT
phi096 4 4.04 AGGTG NEDTCCACCATTTGACACTTAGGCA 232 / 241 0.48 fl2
GCGTAGGACGACCGTTGAA
phi079 4 64 4.05 AGATG 6FAMTGGTGCTCGTTGCCAAATCTACGA 179 / 196 0.73 uaz69b, bnlg1621a
GCAGTGGTGGTTTCGAACAGACAA
phi438301 4 102 4.05 ACC NEDCCTTCATTGTTCGGCTGG 210 / 215 0.68 umc66a, rz446a
ACGAAGCTGATGATCTAACGCT
phi093 4 141 4.08 AGCT HEXAGTGCGTCAGCTTCATCGCCTACAAG 283 / 295 0.62 npi449b, rz476a
AGGCCATGCATGCTTGCAACAATGGATACA
phi076 4 178 4.11 AGCGGG HEXTTCTTCCGCGGCTTCAATTTGACC 160 / 174 0.65 csu315b
GCATCAGGACCCGCAGAGTC
phi109188 5 0 5.00 AAAG 6FAMAAGCTCAGAAGCCGGAGC 162 / 170 0.61 cdo484, csh13
GGTCATCAAGCTCTCTGATCG
phi396160 5 73 5.02 AGGCG NEDGGAGCCTCCTCAACCCTT 300 / 304 0.6 ucr1b, umc1
GCTCGAGGTCCATGAGCA
phi331888 5 88 5.02 AAG  HEXTTGCGCAAGTTTGTAGCTG 129 / 136 0.67 php06012, bnlg653
ACTGAACCGCATGCCAAC
phi330507 5 91.32 5.02 CCG HEXGTAAAGTACGATGCGCCTCCC 134 / 143 0.21 tum3, bnlg386
CGGGGTAGAGGAGAGTTGTG
phi333597 5 93.55 5.02 AAG HEXAGCTCGAGTACCTGCCGAG 213 / 259 0.71 cent5, rz476b
TGCATCTCTGAGACCATCACC
phi085 5 130 5.07 AACGC HEXAGCAGAACGGCAAGGGCTACT 236 / 266 0.79 bnlg1885, csu1164
TTTGGCACACCACGACGA
phi423796 6 31 6.01 AGATG NEDCACTACTCGATCTGAACCACCA 131 / 139 0.45 csu1196, uaz23a
CGCTCTGTGAATTTGCTAGCTC
phi389203 6 81.33 6.03 AGC NEDGACGAAAAGGTGGCTCGT 301 / 310 0.23 tug6, tda51
TGCAGTCCTAGATCAGTTCCAA
phi452693 6 95 6.04 AGCC NEDCAAGTGCTCCGAGATCTTCCA 124 / 142 0.61 bcd221a, npi330
CGCGAACATATTCAGAAGTTTG
phi445613 6 106.7 6.05 ACG NEDTGACCACACACGAGCGAG 99 / 103 0.6 npi608, php10016
GCTCACAATATGTGGCAGAGG
phi070 6 114 6.07 AGCTG NEDGCTGAGCGATCAGTTCATCCAG 76 / 90 0.76 cdo89, bnl8.08c
CCATGGCAGGGTCTCTCAAG
phi364545 6 125.4 6.07 AGC HEXTAAGCAAAGCAAGGCAACC 127 / 138 0.64 php20904, npi280
TCGCCTCACTCTCACACTCC
phi299852 6 129 6.07 AGC 6FAMGATGTGGGTGCTACGAGCC 99 / 132 0.76 uaz251d, umc266c
AGATCTCGGAGCTCGGCTA
phi034 7 33 7.02 CCT 6FAMTAGCGACAGGATGGCCTCTTCT 118 / 145 0.57 bnlg2160, uaz20b
GGGGAGCACGCCTTCGTTCT
phi328175 7 102.12 7.04 AGG HEXGGGAAGTGCTCCTTGCAG 101 / 130 0.71 bnlg1161, bnl8.39
CGGTAGGTGAACGCGGTA
phi069 7 120.3 7.05 GAC NEDAGACACCGCCGTGGTCGTC 187 / 207 0.66 bnl16.06, csu920b
AGTCCGGCTCCACCTCCTTC
phi260485 7 134 7.05 AGC 6FAMTCATTCGACAGAGGCAAAAG 288 / 321 0.75 csu814a, phi051
CATGGGAACTAACACTGGATGC
phi116 7 145.82 7.06 ACTG/ACG*** 6FAMGCATACGGCCATGGATGGGA 151 / 174 0.68 php20728, umc35a
TCCCTGCCGGGACTCCTG
phi420701 8 18 8.00 CCG NEDGATGTTTCAAAACCACCCAGA 291 / 300 0.73 rnp2, bnlg2235
ATGGCACGAATAGCAACAGG
phi233376 8 56.32 8.03 CCG 6FAMCCGGCAGTCGATTACTCC 138 / 155 0.69 cdo1160a, php20727
CGAGACCAAGAGAACCCTCA
phi121 8 77.13 8.04 CCG HEXAGGAAAATGGAGCCGGTGAACCA 96 / 102 0.59 cdo1395e, csu254d
TTGGTCTGGACCAAGCACATACAC
phi115 8 84.71 8.03 AT/ATAC*** HEXGCTCCGTGTTTCGCCTGAA 291 / 312 0.56 rz206c, umc12a
ACCATCACCTGAATCCATCACA
phi100175 8 116.8 8.04 AAGC 6FAMTATCTGACGAATCCCATTCCC 132 / 142 0.81 bcd134c, umc117
GTACGTAACGGACGGACGG
phi015 8 159 8.08 AAAC 6FAMGCAACGTACCGTACCTTTCCGA 80 / 106 0.7 csu223a, rz444a
ACGCTGCATTCAATTACCGGGAAG
phi033 9 41 9.01 AAG NEDATCGAAATGCAGGCGATGGTTCTC 236 / 264 0.24 bz1, csu665b
ATCGAGATGTTCTACGCCCTGAAGT
phi032 9 90 9.04 AAAG NEDCTCCAGCAAGTGATGCGTGAC 223 / 243 0.52 uaz119c, cdo938b
GACACCCGGATCAATGATGGAAC
phi448880 9 108.73 9.04 AAG NEDCGATCCGGAGGAGTTCCTTA 178 / 188 0.72 npi425d, bnlg1270
CCATGAACATGCCAATGC
phi236654 9 124 9.05 CCG 6FAMGCTTGTTTCCCTTGGTCG 120 / 127 0.59 std2a, csu870
GGACTCGCGAATAAGGTCTGG
phi108411 9 126.15 9.05 AGCT 6FAMCGTCCCTTGGATTTCGAC 116 / 123 0.66 bnlg1191, bnlg1156
CGTACGGGACCTGTCAACAA
phi041 10 7 10.00 AGCC NEDTTGGCTCCCAGCGCCGCAAA 196 / 218 0.67 php20626, bnl3.04
GATCCAGAGCGATTTGACGGCA
phi059 10 52 10.02 ACC 6FAMAAGCTAATTAAGGCCGGTCATCCC 146 / 146 0.39 csu625, npi417b
TCCGTGTACTCGGCGGACTC
phi96342 10 53.16 10.02 ATCC 6FAMGTAATCCCACGTCCTATCAGCC 240 / 250 0.59 csu625, npi417b
TCCAACTTGAACGAACTCCTC
phi050 10 63 10.03 AAGC NEDTAACATGCCAGACACATACGGACAG 76 / 87 0.57 umc155, bnlg1526
ATGGCTCTAGCGAAGCGTAGAG
phi301654 10 85.8 10.04 CCG 6FAMGAATGCATGCTTTTCAAGGAC 132 / 138 0.31 npi563, npi269b
CGCACAGAGAGCAGAACG
phi062 10 96 10.04 ACG NEDCCAACCCGCTAGGCTACTTCAA 159 / 165 0.63 bcd386b, umc44a
ATGCCATGCGTTCGCTCTGTATC
phi323152 10 119.2 10.07 CCG HEXTCAGGGAGCTCACCTACTACGG 137 / 147 0.68 bnlg1450, npi254b
CACGACTGCACCGATTAGC
* Min and max allele values were obtained by rounding the former down and the latter up to the next integer
** Nearby public loci/markers in Maizedb; not obtained directly from mapping data. NM = not mapped with sufficient resolution
*** Compound repeat motifs

 


Please Note: Notes submitted to the Maize Genetics Cooperation Newsletter may be cited only with consent of the authors.

Return to the MNL 75 On-Line Index
Return to the Maize Newsletter Index
Return to the Maize Genome Database Page